Bio::Tools::Run::StandAloneWUBlast(3pm) | User Contributed Perl Documentation | Bio::Tools::Run::StandAloneWUBlast(3pm) |
NAME
Bio::Tools::Run::StandAloneWUBlast - Object for the local execution of WU-Blast.
SYNOPSIS
# Do not use directly; use Bio::Tools::Run::StandAloneBlast
DESCRIPTION
See Bio::Tools::Run::StandAloneBlast
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
https://github.com/bioperl/bioperl-live/issues
AUTHOR - Peter Schattner
Email schattner at alum.mit.edu
MAINTAINER - Torsten Seemann
Email torsten at infotech.monash.edu.au
CONTRIBUTORS
Sendu Bala bix@sendu.me.uk (reimplementation)
APPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
new
Title : new Usage : my $obj = Bio::Tools::Run::StandAloneBlast->new(); Function: Builds a newBio::Tools::Run::StandAloneBlast object Returns : Bio::Tools::Run::StandAloneBlast Args : -quiet => boolean # make program execution quiet -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull' # the parsing method, case insensitive
Essentially all BLAST parameters can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional except for -p.
-p Program Name [String] Input should be one of "wublastp", "wublastn", "wublastx", "wutblastn", or "wutblastx". -d Database [String] default = nr The database specified must first be formatted with xdformat. -E Expectation value (E) [Real] default = 10.0 -o BLAST report Output File [File Out] Optional, default = ./blastreport.out ; set by StandAloneBlast.pm
wublast
Title : wublast Usage : $blast_report = $factory->wublast('t/testquery.fa'); or $input = Bio::Seq->new(-id=>"test query", -seq=>"ACTACCCTTTAAATCAGTGGGGG"); $blast_report = $factory->wublast($input); or $seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects $blast_report = $factory->wublast(\@seq_array); Returns : Reference to a Blast object Args : Name of a file or Bio::Seq object or an array of Bio::Seq object containing the query sequence(s). Throws an exception if argument is not either a string (eg a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If argument is string, throws exception if file corresponding to string name can not be found.
_generic_local_wublast
Title : _generic_local_wublast Usage : internal function not called directly Returns : Blast object Args : Reference to calling object and name of BLAST executable
_runwublast
Title : _runwublast Usage : Internal function, not to be called directly Function: makes actual system call to WU-Blast program Example : Returns : Report Blast object Args : Reference to calling object, name of BLAST executable, and parameter string for executable
_setparams
Title : _setparams Usage : Internal function, not to be called directly Function: Create parameter inputs for Blast program Example : Returns : parameter string to be passed to Blast Args : Reference to calling object and name of BLAST executable
2023-01-22 | perl v5.36.0 |