SMILE(1) | General Commands Manual | SMILE(1) |
mlv-smile - inference of structured signals in multiple sequences
mlv-smile <parameter_file>
mlv-smile [-g number]
This manual page documents briefly the mlv-smile command. For more details and example, you should have a look to the documentation files installed with it.
mlv-smile is a program that was primarily made to extract promoter sequences from DNA sequences. The interest of this program is to infer simultaneously several motifs (called boxes) that respects distance constraints. The user has to write in a parameter_file the list of criteria that he wants the signal to respect. In a first step of extraction, all signals respecting these criteria are found. In a second step, they are all statistically evaluated, aiming to detect the ones that are exceptionally represented in the original sequences. Since the 1.4 version mlv-smile allows one to extract such signals on any alphabet in any kind of sequences.
The program usually waits for a parameter file that contains all the criteria needed. The only option is:
The only command you'll use is 'mlv-smile'. You have to give it just one parameter, which is the name of a parameters file which should contain the characteristics of the motifs you want to extract.
You first have to write an alphabet file, which contains the alphabet used to describe the motifs. Then you have to write a parameter file, and you're ready to use mlv-smile.
The first line should contain the type of the alphabet's elements, to choose between "Nucleotides", "Proteins", or "Others". This is to allow mlv-smile to change, for instance, the "A or G" symbol into an R in DNA sequences. Then, on each line, you have to write the elements of the motifs's alphabet.
Example: if you want to extract simple motifs (A,C,G,T) from clean DNA sequences written with a four letters alphabet (A,C,G,T), then you may write an alphabet file containing:
Type:Nucleotides A C G TLet's call this file 'alpha'.
You have to first write an alphabet file. You also need a sequence file, at the FASTA format. Then, you can create a parameter file, using the "mlv-smile -g number_of_boxes" command to help you.
Example: Let's write a parameter file to extract simple motifs. If you don't already have one, let's first create a small DNA file in FASTA format, containing several sequences:
> Seq A AGGCTAGTCAGGGCATGCGATCAGCAGGCATCAGGCGAGCATCGACAGCA > Seq B GGAGAGCGCAGAGCGAGCATCATCATGCAGCATCAGAGATCTTTCTLet's call this file 'seq'.
Our purpose is now to extract from these sequences all motifs of length 13 that appears at least one time in 100% of the sequences, allowing one substitution. We may write the following parameter file (helped with the 'mlv-smile -g 1' command):
FASTA file seq // previously created Output file results Alphabet file alpha //previously created Quorum 100 Total min length 13 Total max length 13 Total substitutions 1 Boxes 1Let's call this file 'param'.
You can launch "mlv-smile" after having created the alphabet and parameter files.
Example: With the previous alphabet, sequences and parameter files, you can now launch mlv-smile: "mlv-smile param". You will obtain the following motifs in the "results" file:
GCGAGCATCAACA 2120210310010 2 Seq 1 Pos 12 Seq 0 Pos 34 2 GCGAGCATCGTCA 2120210312310 2 Seq 1 Pos 12 Seq 0 Pos 34 2The first motif found, GCGAGCATCAACA, appears at position 12 in the second sequence and position 34 in the first one (all positions or sequences counts starts at zero).
You have to add some evaluation lines at the end of the parameter file.
Example: At the bottom of the previous "param" parameter file, you can add:
Shufflings 100 Size k-mer 2which means that the original sequences will be shuffled 100 times, conserving dinucleotides. The significance of the motifs found previously will be computed from their frequency of apparition in the shuffled sequences. The more number of shuffling you do, the more stable are the results, but it's longer to compute.
For this example, you may find such results (in the "results.shuffle"):
STATISTICS ON THE NUMBER OF SEQUENCES HAVING AT LEAST ONE OCCURRENCE Model %right #right %shfl. #shfl. Sigma Chi2 Z-score ============================================================== GCGAGCATCGTCA 100.00% 2 0.50% 0.01 0.10 3.96 19.90 GCGAGCATCAACA 100.00% 2 1.00% 0.02 0.14 3.92 14.07 STATISTICS ON THE TOTAL NUMBER OF OCCURRENCES Model #right #shfl. Sigma Chi2 Z-score ======================================================= GCGAGCATCGTCA 2 0.01 0.10 1.99 19.90 GCGAGCATCAACA 2 0.02 0.14 1.96 14.07
The first block of results shows the statistics on the number of sequences having at least one occurrence. You can read, for each motif found, the frequency of apparition in the original and shuffled sequences, and two statistical scores (Chi2 and Z-score) deduced. Motifs are sorted according to the highest Z-scores. A high Z-score means that the motif appears in a surprising way in the original sequences.
The parameter file should be modified to indicate the characteristics of the structured motifs to infer. You have to write global parameters for the whole motif, and local parameters for each box of it.
Example: Let's extract from the previous "seq" sequences structured motifs composed of 2 boxes of length 5 to 6, but the whole motif must have a length 11. The two boxes may be separated by 10 to 15 nucleotides. You allow at most one substitution in each box, and at least one occurrence of a motif must appear in 100% of the sequences, you may write the following parameter file:
FASTA file seq Output file results Alphabet file alpha Quorum 100 Total min length 11 Total max length 11 Total substitutions 2 Boxes 2 BOX 1 ================ Min length 5 Max length 6 Substitutions 1 Min spacer length 10 Max spacer length 15 BOX 2 ================ Min length 5 Max length 6 Substitutions 1
mlv-smile is an exact combinatorial algorithm. It is not made to infer any kind of motifs. The amount of data where the extraction is made can be very large, but some criteria (in particular the number of substitutions) must be restrained to reasonable values: one or two substitutions allowed in a 10 length motif is ok, but not 6 or 8 substitutions. The notion of spacers is made to avoid the use of to much substitutions.
A bug has been found in the 1.46 version, which could generate wrong results in some particular cases. In particular, results may be wrong for incoherent length criteria. There are still probably a lot of bugs in mlv-smile. This 1.47 version is quite stable, but do not hesitate to report any bug to <lama AT prism.uvsq DOT fr>.
This software has been implemented from an algorithm proposed in
L. Marsan and M.-F. Sagot, Algorithms for extracting structured motifs using a suffix tree with application to promoter and regulatory site consensus identification", J. of Comput. Biol. 7, 2001, 345-360
You should refer to these paper for algorithmic details. If bored by such things, just notice that the extraction step of mlv-smile is exact, which means that all motifs respecting the given criteria are found. Please quote this article if you produce some results given by mlv-smile.
For some examples of applications we made on biological datas (with good results), refer to
A. Vanet and L. Marsan and M.-F. Sagot,"Promoter sequences and algorithmically methods for identifying them", Research in Microbiology 150, 1999, 779-799
and
A. Vanet and L. Marsan and A. Labigne and M.-F. Sagot, Inferring regulatory elements from a whole genome. An application to the analysis of genome of Helicobacter Pylori Sigma 80 family of promoter signals", J. Mol. Biol. 297, 2000, 335-353
This manual page was written by Laurent Marsan <lama AT prism.uvsq DOT fr>, for the Debian GNU/Linux system (but may be used by others).